View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2057_low_43 (Length: 260)
Name: NF2057_low_43
Description: NF2057
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2057_low_43 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 20 - 219
Target Start/End: Original strand, 13799791 - 13799991
Alignment:
| Q |
20 |
tggtcatccatcctcatcaccatctcctttatgcccttcacattattaatattctaaagtaataactaaaattgaaaaatattgattaagtttgtttctc |
119 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
13799791 |
tggtcatccatcctcatcgccatctcctttatgcccttcacattattaatattctaaagtaataactaaaattgcaaaatgttgattaagtttgtttctc |
13799890 |
T |
 |
| Q |
120 |
ttttgttgtgagagtttgttgtgctcgaaaaggtagtgaagcttgttgtctttatttgta-aggcaggtggccagtgaatatgtcatacgccacaaaaaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
13799891 |
ttttgttgtgagagtttgttgtgctcgaaaaggtagtgaagcttgttgtctttatttgcagaggcaggtggtcagtgaatctgtcatacgccacaaaaaa |
13799990 |
T |
 |
| Q |
219 |
g |
219 |
Q |
| |
|
| |
|
|
| T |
13799991 |
g |
13799991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University