View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2057_low_45 (Length: 258)

Name: NF2057_low_45
Description: NF2057
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2057_low_45
NF2057_low_45
[»] chr4 (1 HSPs)
chr4 (16-250)||(27878285-27878519)
[»] chr8 (1 HSPs)
chr8 (166-229)||(31870186-31870249)


Alignment Details
Target: chr4 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 16 - 250
Target Start/End: Complemental strand, 27878519 - 27878285
Alignment:
16 gttaaagggtgggaggttttggagaaaaaggaagatgtagaggaaaattctgctgctgcttattggacaacgttggcaccaaacgtggaggattatagtg 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27878519 gttaaagggtgggaggttttggagaaaaaggaagatgtagaggaaaattctgctgctgcttattggacaacgttggcaccaaacgtggaggattatagtg 27878420  T
116 gaagatttggtagatggattgctgcaggttcaggacaaatgatcagaggaattttgtggtgtggtgatgttactgttgatagattgaaatggggtgatga 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
27878419 gaagatttggtagatggattgctgcaggttcaggacaaatgatcagaggaattttgtggtgcggtgatgttactgttgatagattgaaatggggtgatga 27878320  T
216 tttcatgaagaagaggttgcaacctggttcatctc 250  Q
    |||||||||||||||||||||||||||||| ||||    
27878319 tttcatgaagaagaggttgcaacctggttcttctc 27878285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 166 - 229
Target Start/End: Complemental strand, 31870249 - 31870186
Alignment:
166 attttgtggtgtggtgatgttactgttgatagattgaaatggggtgatgatttcatgaagaaga 229  Q
    |||||||||||||| ||||||||||||||||| |||||||||||| ||||  | ||||||||||    
31870249 attttgtggtgtggggatgttactgttgataggttgaaatggggtaatgagattatgaagaaga 31870186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University