View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2057_low_45 (Length: 258)
Name: NF2057_low_45
Description: NF2057
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2057_low_45 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 16 - 250
Target Start/End: Complemental strand, 27878519 - 27878285
Alignment:
| Q |
16 |
gttaaagggtgggaggttttggagaaaaaggaagatgtagaggaaaattctgctgctgcttattggacaacgttggcaccaaacgtggaggattatagtg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27878519 |
gttaaagggtgggaggttttggagaaaaaggaagatgtagaggaaaattctgctgctgcttattggacaacgttggcaccaaacgtggaggattatagtg |
27878420 |
T |
 |
| Q |
116 |
gaagatttggtagatggattgctgcaggttcaggacaaatgatcagaggaattttgtggtgtggtgatgttactgttgatagattgaaatggggtgatga |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27878419 |
gaagatttggtagatggattgctgcaggttcaggacaaatgatcagaggaattttgtggtgcggtgatgttactgttgatagattgaaatggggtgatga |
27878320 |
T |
 |
| Q |
216 |
tttcatgaagaagaggttgcaacctggttcatctc |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |
|
|
| T |
27878319 |
tttcatgaagaagaggttgcaacctggttcttctc |
27878285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 166 - 229
Target Start/End: Complemental strand, 31870249 - 31870186
Alignment:
| Q |
166 |
attttgtggtgtggtgatgttactgttgatagattgaaatggggtgatgatttcatgaagaaga |
229 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| |||||||||||| |||| | |||||||||| |
|
|
| T |
31870249 |
attttgtggtgtggggatgttactgttgataggttgaaatggggtaatgagattatgaagaaga |
31870186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University