View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2057_low_47 (Length: 258)
Name: NF2057_low_47
Description: NF2057
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2057_low_47 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 15 - 243
Target Start/End: Original strand, 18097389 - 18097617
Alignment:
| Q |
15 |
ggtgagaagtagcttcagttcatcatattcgtttcttagtgatctctgcttccttcagtgttaatgggtttcagtctctttgttctctatgctcaagctg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18097389 |
ggtgagaagtagcttcagttcatcatattcgtttcttagtgatctctgcttccttcagtgttaatgggtttcagtctctttgttctctatgctcaagctg |
18097488 |
T |
 |
| Q |
115 |
cccttttctcctcttgtggattccaaggtttcttccttcaactcttgtagtctcaaaaacccttttactttcaattataagaaattgatttgttcactgt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18097489 |
cccttttctcctcttgtggattccaaggtttcttccttcaactcttgtagtctcaaaaacccttttactttcaattataagaaattgatttgttcactgt |
18097588 |
T |
 |
| Q |
215 |
tcattcaatcacaacaacttgtgattgat |
243 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
18097589 |
tcattcaatcacaacaacttgtgattgat |
18097617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 116 - 158
Target Start/End: Original strand, 28771566 - 28771608
Alignment:
| Q |
116 |
ccttttctcctcttgtggattccaaggtttcttccttcaactc |
158 |
Q |
| |
|
||||||||| ||| || |||||||||||||||||||||||||| |
|
|
| T |
28771566 |
ccttttctcttctcgtcgattccaaggtttcttccttcaactc |
28771608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University