View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2057_low_56 (Length: 241)
Name: NF2057_low_56
Description: NF2057
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2057_low_56 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 3 - 225
Target Start/End: Original strand, 24890394 - 24890615
Alignment:
| Q |
3 |
aatgaaaaaaggagcattacaaatggattggacacaattgaagttgctgctgct-atggaaatggatggggtggcaacaatacactttgtgagtacatca |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24890394 |
aatgaaaaaaggagcattacaaatggattggacacaattgaagtt--tgctatggatggaaatggatggggtggcaacaatacactttgtgagtacatca |
24890491 |
T |
|
| Q |
102 |
attatcaggggttttgccaaatcaataggtttgattgatagcattcaatcaagtagctcaatatttcgaatataaaaaatttaattaaggtttactctat |
201 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
24890492 |
attatgaggggttttgccaaatcaataggtttgattgatagcattcaatcaagtagttcaatatttcgaatataaaaaaattatttaaggtttactctat |
24890591 |
T |
|
| Q |
202 |
caaataccctaataatgaaacaaa |
225 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
24890592 |
caaataccctaataatgaaacaaa |
24890615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University