View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2057_low_67 (Length: 214)
Name: NF2057_low_67
Description: NF2057
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2057_low_67 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 118; Significance: 2e-60; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 21 - 158
Target Start/End: Complemental strand, 27075795 - 27075658
Alignment:
| Q |
21 |
atcgtaattttgtcttgagtgatgtggcctatcccccagccgtgaatgcatgggaagctagtggtttcacacatgcatgagttgccagcgtgatatcttt |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
27075795 |
atcgtaattttgtcttgagtgatgtggcctatcccccagccgtgaatgcatgggaagctagtggtttcgcacatgcatgagttgccactgtgatatcttt |
27075696 |
T |
|
| Q |
121 |
agcgataattgaaaaacataactattttcttttggagt |
158 |
Q |
| |
|
||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
27075695 |
agcaataattgaaaaacataattattttcttttggagt |
27075658 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 21 - 158
Target Start/End: Original strand, 27202516 - 27202653
Alignment:
| Q |
21 |
atcgtaattttgtcttgagtgatgtggcctatcccccagccgtgaatgcatgggaagctagtggtttcacacatgcatgagttgccagcgtgatatcttt |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
27202516 |
atcgtaattttgtcttgagtgatgtggcctatcccccagccgtgaatgcatgggaagctagtggtttcgcacatgcatgagttgccactgtgatatcttt |
27202615 |
T |
|
| Q |
121 |
agcgataattgaaaaacataactattttcttttggagt |
158 |
Q |
| |
|
||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
27202616 |
agcaataattgaaaaacataattattttcttttggagt |
27202653 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University