View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2057_low_69 (Length: 202)
Name: NF2057_low_69
Description: NF2057
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2057_low_69 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 133; Significance: 2e-69; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 14 - 187
Target Start/End: Original strand, 11516697 - 11516869
Alignment:
| Q |
14 |
attatactatgctattaaaattgatactgagaattaaagagacatattgcatacagtttaagtgttatttactatttttggtnnnnnnngttgatcttaa |
113 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
11516697 |
attatactatggtattacaattgatactgagaattaaagagacatattgcatacagtttaagtgttatttactatttttggtaaaaaaagttgatcttaa |
11516796 |
T |
 |
| Q |
114 |
atttttcatatagctttagttttaggaactaaatatgagatagtgatgacgctttattctgacgtatatattgt |
187 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
11516797 |
atttttcataaagctttagttttaggaactaaatatgagatag-gatgacgctttattctgacgtatatattgt |
11516869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University