View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20580_low_7 (Length: 261)
Name: NF20580_low_7
Description: NF20580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20580_low_7 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 5 - 243
Target Start/End: Original strand, 1808755 - 1808991
Alignment:
| Q |
5 |
gagcagcacagatgtaagtttcctttttgagagagnnnnnnngcactagttttattttcagattattttatttccttccatttcttcttcaaactatgag |
104 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1808755 |
gagcagcacaaatgtaagtttcctttttgagaga--aaaaaagcactagttttattttcagattattttatttccttccatttcttcttcaaactatgag |
1808852 |
T |
 |
| Q |
105 |
tcaatgttgtaaaaaggaattggagattgaaacgatgaggcatgacgtggtttaaacggctcgaaccaagacaaaaccacgatcgaaccactgaaataac |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1808853 |
tcaatgttgtaaaaaggaattggagattgaaacgatgaggcatgccgtggtttaaacggctcgaaccaagacaaaaccacgatcgaaccactgaaataac |
1808952 |
T |
 |
| Q |
205 |
cgaaccatgccgaagagtggttcaaggttcaatcggtgg |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1808953 |
cgaaccatgccgaagagtggttcaaggttcaatcggtgg |
1808991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University