View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20581_low_8 (Length: 237)
Name: NF20581_low_8
Description: NF20581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20581_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 145 - 224
Target Start/End: Complemental strand, 48327189 - 48327110
Alignment:
| Q |
145 |
ttgaatacgtatctttgaattgacactaacgtaaagggggttagtattgtaaagcttgagcatgaagccaggtaaggtga |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48327189 |
ttgaatacgtatctttgaattgacactaacgtaaagggggttagtattgtaaagcttgagcatgaagccaggtaaggtga |
48327110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 1 - 75
Target Start/End: Complemental strand, 48327328 - 48327254
Alignment:
| Q |
1 |
aagtaataactagaatattactttgtgatgtaatcttagcaatgataaactataatttaaacatgtttaaaattg |
75 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48327328 |
aagtaataactagaatattactttgtgatgtaatctttgcaatgataaactataatttaaacatgtttaaaattg |
48327254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University