View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20582_high_34 (Length: 238)
Name: NF20582_high_34
Description: NF20582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20582_high_34 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 144; Significance: 7e-76; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 16 - 220
Target Start/End: Complemental strand, 39076540 - 39076332
Alignment:
| Q |
16 |
aaattaacctttcaagacccaagatatataagaatgtatgaaggatata----ctctatgttatattgcttatctcatcacatttcttattctattcatt |
111 |
Q |
| |
|
|||||||||||||| || || ||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39076540 |
aaattaacctttcacaactcaggatatataagaatgtatgaaggatatatatactctatattatattgcttatctcatcacatttcttattctattcatt |
39076441 |
T |
 |
| Q |
112 |
ccccttgattcactcaacaccatgacagaggttctagttatctcgactactacaatccaagcaacaaaacatggtgatgagaactcaactcacaaaatta |
211 |
Q |
| |
|
|||||||||||||||||||||||||||| | ||||||||||||| ||||||||||||||||||| |||||||| |||||| ||||||||||||| ||||| |
|
|
| T |
39076440 |
ccccttgattcactcaacaccatgacagggattctagttatctcaactactacaatccaagcaaaaaaacatgttgatgacaactcaactcacacaatta |
39076341 |
T |
 |
| Q |
212 |
tcgatttag |
220 |
Q |
| |
|
||||||||| |
|
|
| T |
39076340 |
tcgatttag |
39076332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 88 - 219
Target Start/End: Complemental strand, 7399700 - 7399564
Alignment:
| Q |
88 |
atcacatttcttattctattcattccccttgattcactcaacaccatgac---agaggttctagttatctcgactactacaatccaagcaacaaaacatg |
184 |
Q |
| |
|
||||||||||||||| | ||||||| ||| |||||||||||| ||| | |||| ||| | ||||||| |||||||||||| |||||||||| |||| |
|
|
| T |
7399700 |
atcacatttcttattttcatcattcctctt-attcactcaacatcatcatggaagagattcaatttatctcaactactacaatcaaagcaacaaatcatg |
7399602 |
T |
 |
| Q |
185 |
gtg---atgagaactcaactcacaaaattatcgattta |
219 |
Q |
| |
|
||| |||| ||||||| | ||||||||||| ||||| |
|
|
| T |
7399601 |
gtgatgatgacaactcaagtgacaaaattatccattta |
7399564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 149 - 219
Target Start/End: Complemental strand, 34175282 - 34175212
Alignment:
| Q |
149 |
ttatctcgactactacaatccaagcaacaaaacatggtgatgagaactcaactcacaaaattatcgattta |
219 |
Q |
| |
|
|||||||||||| | |||||||||||| ||| ||||||| ||| || |||||||||||||||||| ||||| |
|
|
| T |
34175282 |
ttatctcgactagtgcaatccaagcaagaaatcatggtggtgacaaatcaactcacaaaattatccattta |
34175212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University