View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20582_low_10 (Length: 443)
Name: NF20582_low_10
Description: NF20582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20582_low_10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 116; Significance: 7e-59; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 116; E-Value: 7e-59
Query Start/End: Original strand, 306 - 425
Target Start/End: Complemental strand, 3720157 - 3720038
Alignment:
| Q |
306 |
tataagtcacccttgttgggagtatatagtactattgcgatactaactttccctccatgaaataaaacattaaatggacctaatttggtcttagcatttc |
405 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3720157 |
tataaatcacccttgttgggagtatatagtactattgcgatactaactttccctccatgaaataaaacattaaatggacctaatttggtcttagcatttc |
3720058 |
T |
|
| Q |
406 |
acactttccaaccctattgc |
425 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
3720057 |
acactttccaaccctattgc |
3720038 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University