View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20582_low_25 (Length: 282)
Name: NF20582_low_25
Description: NF20582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20582_low_25 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 15 - 245
Target Start/End: Original strand, 38555830 - 38556060
Alignment:
| Q |
15 |
acaaacatggaacataagttttgtgcaccattgtccagtctccactatattttgactcagtatgaggtctccacgaccaacgtactgcgttagtggtatt |
114 |
Q |
| |
|
||||||||||||||| ||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
38555830 |
acaaacatggaacatgagttttgtgcatcattgtccaatctccactatattttgactcagtatgaggtctccacgaccaacgtactgcgttagtggcatt |
38555929 |
T |
 |
| Q |
115 |
gacaaagaatcaactcccctctcttagctattatagtctcgcctataacttttgattgcataagaagtcttatcacctaaaagtacactcgtctatctac |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
38555930 |
gacaaagaatcaactcccctctcttagctattatagtctcgcctataactttcgatcgcataagaagtcttatcacctcaaagtacactcatctatctac |
38556029 |
T |
 |
| Q |
215 |
caaggtcaacttacaaaataattatttttag |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
38556030 |
caaggtcaacttacaaaataattatttttag |
38556060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 241 - 273
Target Start/End: Original strand, 38556118 - 38556150
Alignment:
| Q |
241 |
tttagttgctctttgtccaatatatatgatgat |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
38556118 |
tttagttgctctttgtccaatatatatgatgat |
38556150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University