View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20582_low_32 (Length: 248)
Name: NF20582_low_32
Description: NF20582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20582_low_32 |
 |  |
|
| [»] scaffold0009 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0009 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 4 - 232
Target Start/End: Complemental strand, 42685 - 42459
Alignment:
| Q |
4 |
gtagattatacttatattttttgtacattaagatatcaaattttaccctttagcaatgtattacataactaattgcaaccataaataatgttttaatgca |
103 |
Q |
| |
|
||||||| |||||||||||||||||||| |||||||| ||||| ||| |||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
42685 |
gtagattgtacttatattttttgtacatcaagatatccaatttcaccaattagcaatgtattacataactaattgcaaccataaataatgtattaatgca |
42586 |
T |
 |
| Q |
104 |
gatttttagagtagtttattaaattctcctatgtgatgatcttaacagtatacatttattaaaataattaagggctttgcagaacgttatgaaggtgttg |
203 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
42585 |
gatttcaagagtagtttattaaattctcctatgtgatgatcttaacagtatacatttattaaaataattaaggactttgc--aacgttatgaaggtgttg |
42488 |
T |
 |
| Q |
204 |
cacactcctctctccggtttatcagattt |
232 |
Q |
| |
|
||||||||||||||||||||||| ||||| |
|
|
| T |
42487 |
cacactcctctctccggtttatcggattt |
42459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University