View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20582_low_37 (Length: 240)
Name: NF20582_low_37
Description: NF20582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20582_low_37 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 19 - 227
Target Start/End: Original strand, 28085719 - 28085927
Alignment:
| Q |
19 |
agtgctgatatttggactggtgtgctgaacaatagtgatattttctgttctcctggatcatactgcccaactacaacacgtaaagtttcttgcgatcgtg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28085719 |
agtgctgatatttggactggtgtgctgaacaatagtgatattttctgttctcctggatcatactgcccaactacaacacgtaaagtttcttgcgatcgtg |
28085818 |
T |
 |
| Q |
119 |
ggtattgatttgtctcattcctccttttgctacagtctaaattgtctaaaattcttgtcaccagataatgttctccaaaactccattattacgcaatgct |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28085819 |
ggtattgatttgtctcattcctccttttgctacagtctaaattgtctaaaattcttgtcaccagataatgttctccaaaactccattattacgcaatgct |
28085918 |
T |
 |
| Q |
219 |
acttttcat |
227 |
Q |
| |
|
||||||||| |
|
|
| T |
28085919 |
acttttcat |
28085927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 19 - 114
Target Start/End: Complemental strand, 41044473 - 41044378
Alignment:
| Q |
19 |
agtgctgatatttggactggtgtgctgaacaatagtgatattttctgttctcctggatcatactgcccaactacaacacgtaaagtttcttgcgat |
114 |
Q |
| |
|
||||||||||||||| ||||||| | ||||||||| |||| ||||||||||| |||||||| || || || |||| | ||||||||||||||| |
|
|
| T |
41044473 |
agtgctgatatttggtctggtgttgtcaacaatagtaatatcttctgttctccaggatcatattgtccttctccaacgagcaaagtttcttgcgat |
41044378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University