View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20583_high_19 (Length: 237)
Name: NF20583_high_19
Description: NF20583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20583_high_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 19 - 224
Target Start/End: Original strand, 39908495 - 39908701
Alignment:
| Q |
19 |
gttttgttcctaattgttttcttctttatttcaaggtgtgaaacaaacacataaacatgatacgtgtcaatgaagctacacatgttcttcttcttgattg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39908495 |
gttttgttcctaattgttttcttctttatttcaaggtgtgaaacaaacacataaacatgatacgtgtcaatgaagctacacatgttcttcttcttgattg |
39908594 |
T |
 |
| Q |
119 |
gttttcaaaacatcatt-aannnnnnnnatcatatggttttctatttgaacgatgccgtggtccttcctttgggctttgggtctttttctagggtatatt |
217 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39908595 |
gttttcaaaacatcattaaattttttttatcatatggttttctatttgaacgatgccgtggtccttcctttgggctttgggtctttttctagggtatatt |
39908694 |
T |
 |
| Q |
218 |
tcttctc |
224 |
Q |
| |
|
||||||| |
|
|
| T |
39908695 |
tcttctc |
39908701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University