View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20583_low_14 (Length: 310)
Name: NF20583_low_14
Description: NF20583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20583_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 16 - 296
Target Start/End: Complemental strand, 51656696 - 51656417
Alignment:
| Q |
16 |
caaaaccttctataacctcatcacttgcttgttcccctcaatcaagttaacatctcaatcaagcttgctgtttctttgttattataacttcatttccttt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
51656696 |
caaaaccttctataacctcatcacttgcttgttcccctcaatcaagttaacatctcaatcaagcttgctgtttctttgttattataact-catttccttt |
51656598 |
T |
 |
| Q |
116 |
ggtgtttctcccacccaaatcctggcggcaatacgatgcgagaaaccctggttgaccgagttaaagtaaatgtaaatattgagaatcttataactcatcc |
215 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51656597 |
ggtgtttctcccacgcaaatcctggcggcaatacgatgcgagaaaccctggttgaccgagttaaagtaaatgtaaatattgagaatcttataactcatcc |
51656498 |
T |
 |
| Q |
216 |
attaataggttctcatagtttagtagattctcatttctcattacttgtatgaatgtgtgagttattgttgatgttgaatct |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
51656497 |
attaataggttctcatagtttagtagattctcatttctcattacctgtatgaatgtgtgagttactgttgatgttgaatct |
51656417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University