View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20583_low_20 (Length: 240)
Name: NF20583_low_20
Description: NF20583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20583_low_20 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 11 - 224
Target Start/End: Original strand, 37974891 - 37975104
Alignment:
| Q |
11 |
caaagggtaaaactttagttaagtacacctcaaatcaatatactatatgttattcattgaaatagaagtaaaaatattttatagtaatggtctatgcatt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
37974891 |
caaagggtaaaactttagttaagtacacctcaaatcaatatactatatgttattcattgaaatagaagtaaaaatattttatagtaatggtctatgaatt |
37974990 |
T |
|
| Q |
111 |
tatatactttattttcctaagatcacgagccaatgcatattatagaggaggtagatggagatgggggaataattaaattacaaagccaatagtgaaaatg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37974991 |
tatatactttattttcctaagatcacgagccaatgcatattatagaggaggtagatggagatgggggaataattaaattacaaagccaatagtgaaaatg |
37975090 |
T |
|
| Q |
211 |
aaagatgacaaatg |
224 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
37975091 |
aaagatgacaaatg |
37975104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University