View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20585_high_21 (Length: 227)
Name: NF20585_high_21
Description: NF20585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20585_high_21 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 37926145 - 37926368
Alignment:
| Q |
1 |
aaatgattacaaactgttccgtttaccactctgtatgcatatcgga------------gatggctttcgacggtcaacggtatttgctccttgcctcaat |
88 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
37926145 |
aaatgattacaaactgttccgtttaccactctgtatgcatatcggagattggaccggagatggctttcgacggtcaacggtatttgcttcttgcctcaat |
37926244 |
T |
|
| Q |
89 |
acaagctgctgatgtgatgcatataggtcatgatggtatgaccatgttaatggtttggtttgatctctacatccatacatcacggttttctttctttagt |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37926245 |
acaagctgctgatgtgatgcatataggtcatgatggtatgaccatgttaatggtttggtttgatctctacatccatacatcacggttttctttctttagt |
37926344 |
T |
|
| Q |
189 |
gacaatctttaattgaatcgatat |
212 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
37926345 |
gacaatctttaattgaatcgatat |
37926368 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University