View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20585_low_10 (Length: 299)
Name: NF20585_low_10
Description: NF20585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20585_low_10 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 11 - 299
Target Start/End: Original strand, 38829470 - 38829758
Alignment:
| Q |
11 |
atcatcatcttccatttctgagaaagttgtttttgtgtcttttcttctaggccaccttagaagagactttaagcgccttgcagcataattgacagagttc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
38829470 |
atcatcatcttccatttctgagaaagttgtttttgtgtcttttcttctaggccaccttagaagaaactttaagcgccttgcagcataattgacagagttc |
38829569 |
T |
 |
| Q |
111 |
gatttgttattatatggggaatttgcagcatcagaattgtttagttcacttgaacatgaatatgattcaggacttgtttgatcataatcagcattagatg |
210 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38829570 |
gatttgttattatatggggaatttgcatcatcagaattgtttagttcacttgaacatgaatatgattcaggacttgtttgatcataatcagcattagatg |
38829669 |
T |
 |
| Q |
211 |
cattctcaattccagtgtacaggaatatctctgcatctggtattctaaatgaagtcccaggactacctccatttacatttatttggatc |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
38829670 |
cattctcaattccagtgtacaggaatatctctgcatctggtattctaaatgaagtcccaggactacctccacttacatttatttggatc |
38829758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University