View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20585_low_5 (Length: 383)
Name: NF20585_low_5
Description: NF20585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20585_low_5 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 345; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 345; E-Value: 0
Query Start/End: Original strand, 19 - 383
Target Start/End: Complemental strand, 38830098 - 38829734
Alignment:
| Q |
19 |
tagacaagcataccgaactcatgaagcagttggtgagcgaaaagattgtgaagacgcaagacatcatcaatgttaagaacaacgatggaagaaccgctct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38830098 |
tagacaagcataccgaactcatgaagcagttggtgagcgaaaagattgtgaagacgcaagacatcatcaatgttaagaacaacgatggaagaaccgctct |
38829999 |
T |
 |
| Q |
119 |
tcatgtatccctgattgagaacatccaatgtgaggtggtggagttgttgatgtctgtgccatcaattgatttgaacattagtgactctgatgagatgacc |
218 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38829998 |
tcatgtatctgtgattgagaacatccaatgtgaggtggtggagttgttgatgtctgtgccatcaattgatttgaacattagtgactctgatgagatgacc |
38829899 |
T |
 |
| Q |
219 |
gctttggatcttttgaagcaaagatcacaatcagcatcttcggatattttaatcaatcggttgatttctgcaggagggataaattgtaagcttagttcgt |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
38829898 |
gctttggatcttttgaagcaaagatcacaatcagcatcttccgatattttaatcaatcggttgatttctgcgggagggataaattgtaagcttagttcgt |
38829799 |
T |
 |
| Q |
319 |
acaattttgaatcaagctgcaccgtgcagccgttgcagaagatccaaataaatgtaaatggaggt |
383 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
38829798 |
acaattttgaatcaagctgcaccgtgcagccgttgcagaagatccaaataaatgtaagtggaggt |
38829734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University