View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20588_low_3 (Length: 258)
Name: NF20588_low_3
Description: NF20588
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20588_low_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 131; Significance: 5e-68; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 3 - 175
Target Start/End: Complemental strand, 31302126 - 31301954
Alignment:
| Q |
3 |
atttaacaacagtgttttagttaaatttataaatttaggttaaannnnnnnnnnnnnnagtctgtttagaatagaaaatcatttattaaattagtgtaat |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31302126 |
atttaacaacagtgttttagttaaatttataaatttaggttaaattttttatttttttagtctgtttagaatagaaaatcatttattaaattagtgtaat |
31302027 |
T |
 |
| Q |
103 |
taatttaggttaatattaattttctaattgatactaatatcaattgatctaattgatacttgttgggacaaaa |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31302026 |
taatttaggttaatattaattttctaattgatactaatatcaattgatctaattgatacttgttgggacaaaa |
31301954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University