View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20589_low_16 (Length: 297)
Name: NF20589_low_16
Description: NF20589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20589_low_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 176; Significance: 8e-95; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 176; E-Value: 8e-95
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 3186530 - 3186313
Alignment:
| Q |
1 |
caggagtaccctcaagtaatgagtttgagatgatgccatgcatccattagtgggaatctcaagagaagtcatttctgtctctttgcctctcctttggctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3186530 |
caggagtaccctcaagtaatgagtttgagatgatgccatgcatccattagtgggaatctcaagagaagtcatttctgtctctttgcctctcctttggctt |
3186431 |
T |
|
| Q |
101 |
ttaaacactaacttgctagctaactttctctcatcatcactcaaaaactaaacaatacttacttccttctatcannnnnnnnnnnnntcatgtctactca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
3186430 |
ttaaacactaacttgctagctaactttctctcatcatcactcaaaaactaaacaatacttacttccttctatca--acacacacacatcatgtctactca |
3186333 |
T |
|
| Q |
201 |
cttctccacccacttccacc |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
3186332 |
cttctccacccacttccacc |
3186313 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 33 - 96
Target Start/End: Original strand, 3221950 - 3222013
Alignment:
| Q |
33 |
atgccatgcatccattagtgggaatctcaagagaagtcatttctgtctctttgcctctcctttg |
96 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| ||||||| |||| ||||||||||||||| |
|
|
| T |
3221950 |
atgccattcatccattagtgggaatctttagagatgtcattttcgtctgtttgcctctcctttg |
3222013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University