View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20589_low_21 (Length: 238)
Name: NF20589_low_21
Description: NF20589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20589_low_21 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 93 - 220
Target Start/End: Complemental strand, 30665977 - 30665850
Alignment:
| Q |
93 |
tcactaagactcttacaagttcatcccatattgacctacatttagggatatagcagctcttcaacccaccataaatgagaattttcaagagatacaatga |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30665977 |
tcactaagactcttacaagttcatcccatattgacctacatttagggatatagcagctcttcaacccaccataaatgagaattttcaagagatacaatga |
30665878 |
T |
|
| Q |
193 |
aggtacaagaaattgacttcagcaatat |
220 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
30665877 |
aggtacaagaaattgacttcagcaatat |
30665850 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University