View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2058_high_20 (Length: 373)
Name: NF2058_high_20
Description: NF2058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2058_high_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 1 - 357
Target Start/End: Complemental strand, 9055862 - 9055510
Alignment:
| Q |
1 |
aaaaaacatcattaacccttcaaacctcaaaaatcaaacacannnnnnnnnnnnnngttcggtgttgttcagnnnnnnngtatcaaacactttctctctc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
9055862 |
aaaaaacatcattaacccttcaaacctcaaaaatcaaacacactctctctct----gttcggtgttgttcagaaaaaaagtatcaaacactttctctctc |
9055767 |
T |
 |
| Q |
101 |
tatctttttcatctttttgttcaaccatgaagaagctctaccataaagcgacggttcatccatcaccaccggtgataaccgaccaactttccttccttcc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9055766 |
tatctttttcatctttttgttcaaccatgaagaagctctaccataaagcgacggttcatccatcaccaccggtgataaccgaccaactttccttccttcc |
9055667 |
T |
 |
| Q |
201 |
ggcaaccatccttaccctagcggcggcgctatcacctgaagacagagaagtcttagcttatctcatctattgttcatccacaacagccccaccaactttc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9055666 |
ggcaaccatccttaccctagcggcggcgctatcacctgaagacagagaagtcttagcttatctcatctattgttcatccacaacagccccaccaactttc |
9055567 |
T |
 |
| Q |
301 |
agcaatttctctggcaacccacgacggagcacggtcaagacaggcgatcatgcaact |
357 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9055566 |
agcaatttctccggaaacccacgacggagcacggtcaagacaggcgatcatgcaact |
9055510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University