View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2058_high_30 (Length: 309)
Name: NF2058_high_30
Description: NF2058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2058_high_30 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 128; Significance: 4e-66; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 53 - 184
Target Start/End: Original strand, 33113093 - 33113224
Alignment:
| Q |
53 |
atattgatcatctttatcttcttttcttgtttattggtgatcatgggaagaccgttacggaaaattttaattaaaaagattaacatgcgaagattctctt |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
33113093 |
atattgatcatctttatcttcttttcttgtttattggtgatcatgggaagaccgttacggaaaattttaattaacaagattaacatgcgaagattctctt |
33113192 |
T |
|
| Q |
153 |
ttatttattggataatacttcctaactaaata |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
33113193 |
ttatttattggataatacttcctaactaaata |
33113224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 17 - 54
Target Start/End: Original strand, 33112926 - 33112963
Alignment:
| Q |
17 |
atgtgtattctttatatgtgttttaatttaatttctat |
54 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33112926 |
atgtgtattctttatatgtgttttaatttaatttctat |
33112963 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University