View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2058_high_41 (Length: 245)
Name: NF2058_high_41
Description: NF2058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2058_high_41 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 38292854 - 38292625
Alignment:
| Q |
1 |
ttatggagatgatctactaggagtaatgatggatacagaaaaaacaaatgatcatggttctaaaaaattgaagatgaatgaaatcatggatgaatgcaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38292854 |
ttatggagatgatctactaggagtaatgatggatacagaaaaaacaaatgatcatggttctaaaaaattgaagatgaatgaaatcatggatgaatgcaag |
38292755 |
T |
|
| Q |
101 |
acctttttctttgctggtcatgaaaccacttcaaacttacttaattggaccgtctttttgttgagtttgcacaaggattggcaagacaaacttagacaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38292754 |
acctttttctttgctggtcatgaaaccacttcaaacttacttaattggaccgtctttttgttgagtttgcacaaggattggcaagacaaacttagacaag |
38292655 |
T |
|
| Q |
201 |
aggttcagcagatttgtggcatggaaattc |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
38292654 |
aggttcagcagatttgtggcatggaaattc |
38292625 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 86 - 126
Target Start/End: Original strand, 1268152 - 1268192
Alignment:
| Q |
86 |
atggatgaatgcaagacctttttctttgctggtcatgaaac |
126 |
Q |
| |
|
|||||||||||||| || ||||||||| ||||||||||||| |
|
|
| T |
1268152 |
atggatgaatgcaaaacatttttcttttctggtcatgaaac |
1268192 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University