View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2058_low_14 (Length: 422)
Name: NF2058_low_14
Description: NF2058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2058_low_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 211; Significance: 1e-115; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 16 - 226
Target Start/End: Original strand, 19577232 - 19577442
Alignment:
| Q |
16 |
cataaggacctaagttaagtattttgcgaagatctttatgagagccccagttgattaaaacaatggaggtgtggttaatgttttggggggtgggtttagc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19577232 |
cataaggacctaagttaagtattttgcgaagatctttatgagagccccagttgattaaaacaatggaggtgtggttaatgttttggggggtgggtttagc |
19577331 |
T |
 |
| Q |
116 |
ataattatgaatttcgcggaaggatgaaacggggtaagatgcgtattgaattgaatcggattcgagaatacggaaaagggttttgagtgcgcagagggaa |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19577332 |
ataattatgaatttcgcggaaggatgaaacggggtaagatgcgtattgaattgaatcggattcgagaatacggaaaagggttttgagtgcgcagagggaa |
19577431 |
T |
 |
| Q |
216 |
tcgacgtcgga |
226 |
Q |
| |
|
||||||||||| |
|
|
| T |
19577432 |
tcgacgtcgga |
19577442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 166; Significance: 1e-88; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 166; E-Value: 1e-88
Query Start/End: Original strand, 238 - 403
Target Start/End: Complemental strand, 4578725 - 4578560
Alignment:
| Q |
238 |
atgggaaaggtggtggcgtgtgcgacggtgatcggagcaacggcggcgtgtgcagtggcgacggtgttgattcatcgttacgtgaagaaatcgaagcgat |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4578725 |
atgggaaaggtggtggcgtgtgcgacggtgatcggagcaacggcggcgtgtgcagtggcgacggtgttgattcatcgttacgtgaagaaatcgaagcgat |
4578626 |
T |
 |
| Q |
338 |
ggggtaaagcaatagcgatattgaaggaatttgaagagaagtgtgcgacaccaacgttgaagctga |
403 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4578625 |
ggggtaaagcaatagcgatattgaaggaatttgaagagaagtgtgcgacaccaacgttgaagctga |
4578560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University