View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2058_low_17 (Length: 408)
Name: NF2058_low_17
Description: NF2058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2058_low_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 320; Significance: 1e-180; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 320; E-Value: 1e-180
Query Start/End: Original strand, 29 - 389
Target Start/End: Original strand, 4189312 - 4189684
Alignment:
| Q |
29 |
tagaagctagaaaggaaaacaaaataagatacacgattgcatatctttgtgacttggtctacatgaagttgaatcaagaactctcaactttgtttatgca |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4189312 |
tagaagctagaaaggaaaacaaaataagatacacgattgcatatctttgtgacttggtctacatgaagttgaatcaagaactctcaactttgtttatgca |
4189411 |
T |
 |
| Q |
129 |
agaagcagtgcagcaccggcaaagaatggtagcatgaaaaagctgcttctgcgaacaaccgcgttgcttggacttgaagcaactgggttatcagacattg |
228 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
4189412 |
agaagcagtgcagcaccagcaaagaatggtagcatgaaaaagctgcttctgcgaacaaccgcgttgcttggacttgaagcaactggattatcagacattg |
4189511 |
T |
 |
| Q |
229 |
attctccggtggaaggtgacggtgaagaagctggagatggtgaagcagcagtagggaaaggtgggctcatacttggactcatgttcatgcttgggctcat |
328 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4189512 |
attctccggtggaaggtgacggtgaagaagctggagatggtgaagcatcagtagggaaaggtgggctcatacttggactcatgttcatgcttgggctcat |
4189611 |
T |
 |
| Q |
329 |
gctc------------gggctttctggtggcaatgattcaggggaggaggcaggtgaaggagtgtgcagcatg |
389 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4189612 |
gctcgggctctggcttgggctttctggtggcaatgattcaggggaggaggcaggtgaaggagtgtgcagcatg |
4189684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University