View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2058_low_21 (Length: 375)
Name: NF2058_low_21
Description: NF2058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2058_low_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 110; Significance: 2e-55; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 153 - 294
Target Start/End: Complemental strand, 9248856 - 9248716
Alignment:
| Q |
153 |
agttttttgacaatagaatgggtgtaaagttgaattatgcaaagttccttcaaaaaatatccagatgtctatgtctgaaaccatacatcaaacttgaaac |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| || | || ||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
9248856 |
agttttttgacaatagaatgggtgtaaagttgaattatgcaaagttaggtcgataa-tatccagatgtctttgtctgaaaccatacatcaaacttgaaac |
9248758 |
T |
 |
| Q |
253 |
attaaccattcaaaaattaggcaaagaatgattaaccgaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9248757 |
attaaccattcaaaaattaggcaaagaatgattaaccgaaat |
9248716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 41 - 128
Target Start/End: Complemental strand, 9248930 - 9248843
Alignment:
| Q |
41 |
gtatatgataagagaagaaatgaaatatctgcatccttcnnnnnnnctgaaatatatgcagagaatgggtgcaaagttttttgacaat |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
9248930 |
gtatatgataagagaagaaatgaaatatctgcatccttcaaaaaaactgaaatatatgcagagaatgggtgtaaagttttttgacaat |
9248843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 323 - 361
Target Start/End: Complemental strand, 9247870 - 9247832
Alignment:
| Q |
323 |
ttagaacaaattgatgcgttgacacaatcggttaatttt |
361 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9247870 |
ttagaacaaattgatgcgttgacacaatcggttaatttt |
9247832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University