View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2058_low_39 (Length: 281)
Name: NF2058_low_39
Description: NF2058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2058_low_39 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 7 - 265
Target Start/End: Original strand, 47441603 - 47441861
Alignment:
| Q |
7 |
tagattatactttaccaactagaagccaggaaaactttcactgccatatttattatcattctttccctggttactggaaaggaatactttgtttcatatg |
106 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47441603 |
tagattataatttaccaactagaagccaggaaaactttcactgccatatttattatcattctttccctggttactggaaaggaatactttgtttcatatg |
47441702 |
T |
|
| Q |
107 |
gtgatgccaaatatcgctaatttcctagtcttgaatctgctacatcagagcaattggtattgcttctctctcattgaagggagcctttgattttgatgct |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
47441703 |
gtgatgccaaatatcgctaatttcctagtcttgaatctgctacatcagagcaattggtattgcttctctctcattgaaggtagcctttgattttgatgct |
47441802 |
T |
|
| Q |
207 |
cttgatcgtcttgatgaagatgatggtgaccgggaagaggaagctgacttaaccttttt |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47441803 |
cttgatcgtcttgatgaagatgatggtgaccgggaagaggaagctgacttaaccttttt |
47441861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University