View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2058_low_44 (Length: 249)
Name: NF2058_low_44
Description: NF2058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2058_low_44 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 938422 - 938187
Alignment:
| Q |
1 |
ccctatgaagcattgacatagacatagacacatgattagatgtgtcagtgcggtgtcggtattagacactaacacgtgtcaaacaccggacacgccttca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
938422 |
ccctatgaagcattgacatagacatagacacatgattagatgtgtcagtgcggtgtcggtattagacactaacacgtgtcgaacaccggacacgccttca |
938323 |
T |
|
| Q |
101 |
attaaaagtgtcagtgttacaacaagtaatgtcgatattgaactcataaatcattcaatactatacgttagccattatgattcatcaaatgtgtgagaac |
200 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
938322 |
attaaaagtgtcagtgctacaacaagtaatgtctatattgaactcataaatcattcaatactatacgttagccattatgattcatcaaatgtgtgagaac |
938223 |
T |
|
| Q |
201 |
attgcatgttgtatacttctatctgccggtgcccct |
236 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |
|
|
| T |
938222 |
attgcatgttgtatacttctatctgccagtgcccct |
938187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 65 - 121
Target Start/End: Original strand, 46266452 - 46266508
Alignment:
| Q |
65 |
gacactaacacgtgtcaaacaccggacacgccttcaattaaaagtgtcagtgttaca |
121 |
Q |
| |
|
|||||||||| |||||| ||||||||||| ||||||||| | ||||||||||||| |
|
|
| T |
46266452 |
gacactaacatgtgtcagacaccggacacaccttcaatttgagatgtcagtgttaca |
46266508 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University