View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2058_low_45 (Length: 249)

Name: NF2058_low_45
Description: NF2058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2058_low_45
NF2058_low_45
[»] chr7 (1 HSPs)
chr7 (1-106)||(3309818-3309924)
[»] chr2 (2 HSPs)
chr2 (177-226)||(29293055-29293104)
chr2 (186-226)||(3668110-3668150)
[»] chr8 (2 HSPs)
chr8 (187-226)||(7939674-7939713)
chr8 (187-227)||(16063085-16063125)
[»] chr6 (1 HSPs)
chr6 (177-225)||(1603995-1604043)
[»] chr3 (1 HSPs)
chr3 (177-225)||(23516581-23516629)


Alignment Details
Target: chr7 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 1 - 106
Target Start/End: Complemental strand, 3309924 - 3309818
Alignment:
Q  1 cctcaatttcttttgacaaatggagtatcctaacacaataagaaaatagataccacaaaatgagattttaattaag-ttttcaccaacaataaactaatt 99  Q
    ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
T  3309924 cctcaatttcttttgaccaatggagtatcctaacacaataagaaaatagataccacaaaatgagattttaattaagtttttcaccaacaataaactaatt 3309825  T
Q  100 aagtata 106  Q
    |||||||    
T  3309824 aagtata 3309818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 34; Significance: 0.0000000003; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 177 - 226
Target Start/End: Original strand, 29293055 - 29293104
Alignment:
Q  177 ttattgctctttaaccggtgccccgagagcaccggttagcaacaccctta 226  Q
    ||||| ||| ||||||||||||||| | ||||||||||||||||||||||    
T  29293055 ttattactccttaaccggtgccccgggggcaccggttagcaacaccctta 29293104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 186 - 226
Target Start/End: Complemental strand, 3668150 - 3668110
Alignment:
Q  186 tttaaccggtgccccgagagcaccggttagcaacaccctta 226  Q
    ||||||| |||||||||| |||||||||||||| |||||||    
T  3668150 tttaaccagtgccccgagggcaccggttagcaagaccctta 3668110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 32; Significance: 0.000000005; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 187 - 226
Target Start/End: Complemental strand, 7939713 - 7939674
Alignment:
Q  187 ttaaccggtgccccgagagcaccggttagcaacaccctta 226  Q
    ||||||||| ||||||| ||||||||||||||||||||||    
T  7939713 ttaaccggtaccccgagggcaccggttagcaacaccctta 7939674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 187 - 227
Target Start/End: Complemental strand, 16063125 - 16063085
Alignment:
Q  187 ttaaccggtgccccgagagcaccggttagcaacacccttaa 227  Q
    |||||| |||||||| ||||||||||||||| |||||||||    
T  16063125 ttaacccgtgccccgggagcaccggttagcagcacccttaa 16063085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 177 - 225
Target Start/End: Complemental strand, 1604043 - 1603995
Alignment:
Q  177 ttattgctctttaaccggtgccccgagagcaccggttagcaacaccctt 225  Q
    ||||||||  |||||| |||||||| | |||||||||||||||||||||    
T  1604043 ttattgcttcttaaccagtgccccgggggcaccggttagcaacaccctt 1603995  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 177 - 225
Target Start/End: Original strand, 23516581 - 23516629
Alignment:
Q  177 ttattgctctttaaccggtgccccgagagcaccggttagcaacaccctt 225  Q
    |||||| || |||||| |||||||| | |||||||||||||||||||||    
T  23516581 ttattgttccttaaccagtgccccgggggcaccggttagcaacaccctt 23516629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University