View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2058_low_50 (Length: 240)
Name: NF2058_low_50
Description: NF2058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2058_low_50 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 17 - 154
Target Start/End: Complemental strand, 3310192 - 3310058
Alignment:
| Q |
17 |
attaaagagggaaacttcaatggtttatcatgtttaccatactgtgtaatccaaagcagattttcactccacactatcattgttggtcaagttgttttta |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||| || |
|
|
| T |
3310192 |
attaaagagggaaacttcaatggtttatcatgtttaccatattgtgtaatccaaagcagattttcactccacactatca---ttggtcaagttgtttcta |
3310096 |
T |
 |
| Q |
117 |
aatttatggtcactctaaaattcaaacttcgcatatat |
154 |
Q |
| |
|
|||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
3310095 |
aatttatggttactttaaaattcaaacttcgcatatat |
3310058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 182 - 224
Target Start/End: Complemental strand, 3310003 - 3309959
Alignment:
| Q |
182 |
atatatataggga--atatatacacacaaaatagattacggttcc |
224 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3310003 |
atatatatagggagtatatatacacacaaaatagattacggttcc |
3309959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University