View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2058_low_51 (Length: 238)

Name: NF2058_low_51
Description: NF2058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2058_low_51
NF2058_low_51
[»] chr5 (1 HSPs)
chr5 (1-223)||(38802423-38802645)


Alignment Details
Target: chr5 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 38802423 - 38802645
Alignment:
1 atgtcgtctgaaagtagaccttggaacaaattatgccgtcataatcatactttcgaaaccatgtgtgattttttaatagatgtggggtcgataaagttgc 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
38802423 atgtcgtctgaaagtagaccttggaacaaattatgccgtcataatcatactttcgaaaccatgtgtgattttttaatagacgtggggtcgataaagttgc 38802522  T
101 tccttttctttctatacattttattacataggtttaggcttaccattccctgcttttgatccatggaggaatgaagaggtgagggacctaagaacaagaa 200  Q
    ||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38802523 tccttgtctttttatacattttattacataggtttaggcttaccattccctgcttttgatccatggaggaatgaagaggtgagggacctaagaacaagaa 38802622  T
201 gctatacaaattaaggtgttatt 223  Q
    |||||||||||||||||||||||    
38802623 gctatacaaattaaggtgttatt 38802645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University