View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2058_low_53 (Length: 237)
Name: NF2058_low_53
Description: NF2058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2058_low_53 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 37879926 - 37880155
Alignment:
| Q |
1 |
gtgcgtggcagatccggatttgttgagagaacaacaaccttcgacgacgccatgcctagtttataggagagtttgttttgtttgttcagcttcggcttcg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37879926 |
gtgcgtggcagatccggatttgttgagagaacaacaaccttcgatgacgccatgcctagtttataggagagtttgttttgtttgttcagcttcggcttcg |
37880025 |
T |
 |
| Q |
101 |
gcttcaaccctaagaaaagattcagaagcaatagcacaacaatgaaacaatagctatggcctttacttgagtttggatttttaagaattaagattaataa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
37880026 |
gcttcaaccctaagaaaagattcagaagcaatagcacaacaatgaaacaatagctatggcctttacttgagtttggattt-------ttaagattaataa |
37880118 |
T |
 |
| Q |
201 |
tcacatgcatgcaaatcctttatatagctaccctttc |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37880119 |
tcacatgcatgcaaatcctttatatagctaccctttc |
37880155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University