View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20592_high_8 (Length: 360)
Name: NF20592_high_8
Description: NF20592
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20592_high_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 60 - 342
Target Start/End: Complemental strand, 37511903 - 37511621
Alignment:
| Q |
60 |
gtgaactcaatactaaccatggcggctatccaggaatcacggaaggatcaacccaaaacggcaccgtttcaaccagcgccgccttttgttgattcctacg |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37511903 |
gtgaactcaatactaaccatggcggctatccaggaatcacggaaggatcaacccaaaacggcaccgtttcaaccagcgccgccttttgttgattcctacg |
37511804 |
T |
|
| Q |
160 |
ccaaagatgcaatgcttgcttggtttcacggcgagttcgccgccgccaacgcgatcattgatgctctctgtggtcaccttgcgcagattgctccatcctc |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37511803 |
ccaaagatgcaatgcttgcttggtttcacggcgagttcgccgccgccaacgcgatcattgatgctctctgtggtcaccttgcgcagattgctccatcctc |
37511704 |
T |
|
| Q |
260 |
caacgattacgattcagcttttacggccgtacaccggcggcggttcaactggatccctgttattcagatgcagaagtatcatt |
342 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37511703 |
caacgattacgattcagcttttacggccgtacaccggcggcggttcaactggatccctgttattcagatgcagaagtatcatt |
37511621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 62; Significance: 1e-26; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 245 - 342
Target Start/End: Complemental strand, 53753059 - 53752962
Alignment:
| Q |
245 |
gattgctccatcctccaacgattacgattcagcttttacggccgtacaccggcggcggttcaactggatccctgttattcagatgcagaagtatcatt |
342 |
Q |
| |
|
|||||||||||| |||||||||| ||||| |||||||||| |||||||||||||||| ||||||||||||||||||||| |||||| | |||||||| |
|
|
| T |
53753059 |
gattgctccatcttccaacgattgcgattttgcttttacggtcgtacaccggcggcggctcaactggatccctgttattctgatgcaaaggtatcatt |
53752962 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 46; Significance: 4e-17; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 153 - 230
Target Start/End: Complemental strand, 40225144 - 40225067
Alignment:
| Q |
153 |
tcctacgccaaagatgcaatgcttgcttggtttcacggcgagttcgccgccgccaacgcgatcattgatgctctctgt |
230 |
Q |
| |
|
|||||||||||||| || || || |||||||||||||||||||||||||| |||||||| ||||| || ||||||||| |
|
|
| T |
40225144 |
tcctacgccaaagacgctatcctcgcttggtttcacggcgagttcgccgctgccaacgcaatcatcgacgctctctgt |
40225067 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 168 - 211
Target Start/End: Original strand, 51588081 - 51588124
Alignment:
| Q |
168 |
gcaatgcttgcttggtttcacggcgagttcgccgccgccaacgc |
211 |
Q |
| |
|
||||| || |||||||||||||||||||||||||| |||||||| |
|
|
| T |
51588081 |
gcaatcctcgcttggtttcacggcgagttcgccgctgccaacgc |
51588124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University