View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20592_low_12 (Length: 253)
Name: NF20592_low_12
Description: NF20592
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20592_low_12 |
 |  |
|
| [»] scaffold0240 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 1 - 115
Target Start/End: Complemental strand, 34387625 - 34387511
Alignment:
| Q |
1 |
ttggattatcaaaatacggattttcatcaaagttaaaggtgattgaatagcctgatttggcatcttgattgtcttcaacctcaatagaattgaggtattc |
100 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
34387625 |
ttggattatcaaaatatggattttcatcaaagttaaaggtgattgaatagcctgatttggcatcttgattgtcttcaacctcaatagaattgaggtactc |
34387526 |
T |
 |
| Q |
101 |
atcaaatatctcgcg |
115 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
34387525 |
atcaaatatctcgcg |
34387511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 21395993 - 21396081
Alignment:
| Q |
1 |
ttggattatcaaaatacggattttcatcaaagttaaaggtgattgaatagcctgatttggcatcttgattgtcttcaacctcaatagaa |
89 |
Q |
| |
|
|||| ||||||||||| ||||| ||||||||||||||||||||||||||| ||| | |||||||||| |||||||||||||||||| |
|
|
| T |
21395993 |
ttggtttatcaaaataaggattgtcatcaaagttaaaggtgattgaataggctgtactaacatcttgattatcttcaacctcaatagaa |
21396081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0240 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: scaffold0240
Description:
Target: scaffold0240; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 4 - 211
Target Start/End: Complemental strand, 10409 - 10201
Alignment:
| Q |
4 |
gattatcaaaatacggattttcatcaaagttaaaggtgattgaatagcctgatttggcatcttgattgtcttcaacctcaatagaattgaggtattcatc |
103 |
Q |
| |
|
||||||||||||| | ||| |||| |||||||||||||||||||||| ||| | |||||||||| |||||||||||||||||| | || || ||||| |
|
|
| T |
10409 |
gattatcaaaataggcattgtcattaaagttaaaggtgattgaataggctgtactaacatcttgattatcttcaacctcaatagaactaagatactcatc |
10310 |
T |
 |
| Q |
104 |
aaatatctcgcggtccttg-tgatcaattgcctagcaaggattggatgggccgtaaaagcacgggaccagaatttgggaatagacttgagaagttccccg |
202 |
Q |
| |
|
||| |||||| | |||||| || |||| | | ||| |||||||||||||||||||||| | ||| ||||| |||| || |||||||| || |||| |
|
|
| T |
10309 |
aaaaatctcgtgatccttgttgttcaaaaggttgacaatgattggatgggccgtaaaagcatgtagccaaaatttaggaacagtcttgagaactttcccg |
10210 |
T |
 |
| Q |
203 |
cgcttatca |
211 |
Q |
| |
|
|| |||||| |
|
|
| T |
10209 |
cgtttatca |
10201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University