View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20593_high_21 (Length: 305)
Name: NF20593_high_21
Description: NF20593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20593_high_21 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 13 - 259
Target Start/End: Complemental strand, 4282735 - 4282487
Alignment:
| Q |
13 |
attctagaagacttgtgtgcaaatttattttcttaaatataatatctctctcagagatgtctccaccaggccttagcttgttgtcaaaagccgtcaaccg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4282735 |
attctagaagacttgtgtgcaaatttattttcttaaatat-----ctctctcagagatgtctccaccaggccttagcttgttgtcaaaagccgtcaaccg |
4282641 |
T |
|
| Q |
113 |
tgtaaacgctcttgatattttatacttgtaggcagtg-------aatggctaactaaacatcatgatttagacaaaattcagcatgttttgtatttttag |
205 |
Q |
| |
|
||||||||||||||| |||||||||||||||| || | ||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
4282640 |
tgtaaacgctcttgaaattttatacttgtaggaagagcctgggcaatggctaactaaacatcacgatttagacaaaattcagcatgttttgtatttttag |
4282541 |
T |
|
| Q |
206 |
aagcttatttcctactttagaagcttattttatcggaatacattggttattgta |
259 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4282540 |
aagcttaattcctactttagaagcttattttatcggaatacattggttattgta |
4282487 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 122 - 197
Target Start/End: Original strand, 33856046 - 33856128
Alignment:
| Q |
122 |
tcttgatattttatacttgtaggcagtg-------aatggctaactaaacatcatgatttagacaaaattcagcatgttttgt |
197 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||| |||||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
33856046 |
tcttgatattttatacttgtaggcagagcctgggcaatggcaaactaaacatcatgatttagacaatatttagcatgttttgt |
33856128 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 150 - 190
Target Start/End: Original strand, 33867100 - 33867140
Alignment:
| Q |
150 |
aatggctaactaaacatcatgatttagacaaaattcagcat |
190 |
Q |
| |
|
|||||| ||| |||||||| ||||||||||||||||||||| |
|
|
| T |
33867100 |
aatggcaaaccaaacatcacgatttagacaaaattcagcat |
33867140 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University