View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20593_high_23 (Length: 277)
Name: NF20593_high_23
Description: NF20593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20593_high_23 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 19 - 259
Target Start/End: Complemental strand, 45969444 - 45969204
Alignment:
| Q |
19 |
atatggcccctcgtaaaatttatgccagcctcgccaccgtccacaacaaccagatccttcttgaatatcgccgcatagtttagtcactactcacttgatg |
118 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45969444 |
atatggcccctcgtaaaatttatgtcagcttcgccaccgtctacaacaaccagatccttcttgaatatcgccgcattgtttagtcactactcacttgatg |
45969345 |
T |
|
| Q |
119 |
atcattctctgtcccccaatcagtacaccatccctgaaaacatctacattggattgctccatcagggtgaggagtgaggagctgttgcatatcatgttta |
218 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45969344 |
atcattctccgtcccccaatcagtacaccatccctgaaaacatctacattggattgctccatcagggtgaggagtgaggagctgttgcatatcatgttta |
45969245 |
T |
|
| Q |
219 |
tgcagttttttgctccatcccttaaattcattgaccagtct |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
45969244 |
tgcagttttttgctccatcccttaaattcatggaccagtct |
45969204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University