View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20593_high_28 (Length: 234)
Name: NF20593_high_28
Description: NF20593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20593_high_28 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 19 - 217
Target Start/End: Original strand, 38008287 - 38008485
Alignment:
| Q |
19 |
aaaatgttccgaccatgacacgcgggtggcctgcaatctatatcttaagatcatgtgactgtgacagatgcactcaactcagacaaactgagactgtttg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38008287 |
aaaatgttccgaccatgacacgcgggtggcctgcaatctatatcttaagatcatgtgactgtgacagatgcactcaactcagacaaactgagactgtttg |
38008386 |
T |
|
| Q |
119 |
acaaattcagatttcccgctctaccctctgcttgcataaaatgtctgtacgtgcatgcatgttctctacaatttgctcaggcccaattgcatatctctg |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38008387 |
acaaattcagatttcccgctctaccctctgcttgcataaaatgtctgtacgtgcatgcatgttctctacaatttgctcaggcccaattgcatatctctg |
38008485 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University