View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20593_high_29 (Length: 222)
Name: NF20593_high_29
Description: NF20593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20593_high_29 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 23 - 206
Target Start/End: Complemental strand, 30480721 - 30480538
Alignment:
| Q |
23 |
aatggacttgagaatccaaaaaactctgcaaaaatgtcatctgcattcctcggattgaaccgaaacgatccaggcatatctcctgtggaatagaaactag |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
30480721 |
aatggacttgagaatccaaaaaactctgcaaaaatgtcatctgcattcctcggattgaaccgaaacgacccaggcatatctcctgtggaatagaaactag |
30480622 |
T |
 |
| Q |
123 |
ttccacctccactaccagcatcaggaggaggaacttgaccctttaaaccttcttccccatattgatcatagattgctttctttt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30480621 |
ttccacctccactaccagcatcaggaggaggaacttgaccctttaaaccttcttccccatattgatcatagattgctttctttt |
30480538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 170 - 206
Target Start/End: Complemental strand, 4142315 - 4142279
Alignment:
| Q |
170 |
ccttcttccccatattgatcatagattgctttctttt |
206 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
4142315 |
ccttcttctccatattgatcataaattgctttctttt |
4142279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University