View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20593_low_12 (Length: 414)
Name: NF20593_low_12
Description: NF20593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20593_low_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 359; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 359; E-Value: 0
Query Start/End: Original strand, 20 - 393
Target Start/End: Original strand, 52477389 - 52477760
Alignment:
| Q |
20 |
acaaacgtgtttcctattttaactttgttttctgttgtcaactatttgtatggaagacaacttcattgtttagttttgaatatagtgaaaaactgaaagt |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
52477389 |
acaaacgtgtttcctattttaactttgttttctgttgtcaactatttgtatggaagacaacttcattgtttagtttttaatatagtgaaaaactgaaagt |
52477488 |
T |
|
| Q |
120 |
gttttctgaaatcaaagtttgcaagatcagagaagtgtcttgcgttttgttttgaagatgcaattgtgactagaagtgataaggaacataagttccaagg |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52477489 |
gttttctgaaatcaaagtttgcaagatcagagaagtgtcttgcgttttgttttgaagatgcaattgtgactagaagtgataaggaacataagttccaagg |
52477588 |
T |
|
| Q |
220 |
acaaaaccagcatgagagtcagagtcaaaaataaatcaagtgaaataacggatttggttaccggaggcggcgaagtcggacaaattcatagacacctttg |
319 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52477589 |
acaaaaccagcatgagagtc--agtcaaaaataaatcaagtgaaataacggatttggttaccggaggcggcgaagtcggacaaattcatagacacctttg |
52477686 |
T |
|
| Q |
320 |
gtactgttgatggcagccatgaagtgcagtgtctctcctatgaagggtaatcctcgatttcccggaggaatgcc |
393 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52477687 |
gtactgttgatggcagccatgaagtgcagtgtctctcctatgaagggtaatcctcgatttcccggaggaatgcc |
52477760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University