View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20593_low_19 (Length: 324)
Name: NF20593_low_19
Description: NF20593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20593_low_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 19 - 308
Target Start/End: Complemental strand, 30480827 - 30480538
Alignment:
| Q |
19 |
gattcctcctccttctccaaaagagccaaacatatcatcaccaaacatccccccagagaaccttgatctcataccaccaacaccacctcttccacccatg |
118 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
30480827 |
gattcctcctccttctccaaaagatccaaacatatcatcaccaaacatccccccagagaaccttgatctcataccaccaccaccacctcttccacccatg |
30480728 |
T |
|
| Q |
119 |
ccaccaaatggacttgagaatccaaaaaactctgcaaaaatgtcatctgcattcctcggattgaaccgaaacgatccaggcatatctcctgtggaataga |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
30480727 |
ccaccaaatggacttgagaatccaaaaaactctgcaaaaatgtcatctgcattcctcggattgaaccgaaacgacccaggcatatctcctgtggaataga |
30480628 |
T |
|
| Q |
219 |
aactagttccacctccactaccagcatcaggaggaggaacttgaccctttaaaccttcttccccatattgatcatagattgctttctttt |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30480627 |
aactagttccacctccactaccagcatcaggaggaggaacttgaccctttaaaccttcttccccatattgatcatagattgctttctttt |
30480538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 272 - 308
Target Start/End: Complemental strand, 4142315 - 4142279
Alignment:
| Q |
272 |
ccttcttccccatattgatcatagattgctttctttt |
308 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
4142315 |
ccttcttctccatattgatcataaattgctttctttt |
4142279 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University