View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20593_low_23 (Length: 298)
Name: NF20593_low_23
Description: NF20593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20593_low_23 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 153; Significance: 4e-81; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 133 - 289
Target Start/End: Original strand, 31859070 - 31859226
Alignment:
| Q |
133 |
tttccattcatagctttacttgaaccactaaccctacttgtttcactacctttagaatcttcaccttttgctcttgttgaaataaatgcttctttatgtt |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31859070 |
tttccattcatagctttacttgaaccactaaccctacttgtttcaccacctttagaatcttcaccttttgctcttgttgaaataaatgcttctttatgtt |
31859169 |
T |
 |
| Q |
233 |
ccatgtatccattacttaatcctaataagcagttacttttctggtatagtgatgatg |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31859170 |
ccatgtatccattacttaatcctaataagcagttacttttctggtatagtgatgatg |
31859226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 1 - 144
Target Start/End: Complemental strand, 31859009 - 31858866
Alignment:
| Q |
1 |
ggcaaccataatgcttgaaaaaatgggagccaccgtcgttgctgtaggtgacggacaacaggcggtggatgctctaaatggcatgcctggtgttgaaaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31859009 |
ggcaaccataatgcttgaaaaaatgggagccaccgttgttgctgtaggcgacggacaacaggcggtggatgctctaaatggcatgcctggtgttgaaaga |
31858910 |
T |
 |
| Q |
101 |
aacacaataacatctcaaactgagattctatgtttccattcata |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
31858909 |
aacacaataacatctcaaactgagattctaagtttcccttcata |
31858866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 2 - 75
Target Start/End: Original strand, 8870251 - 8870324
Alignment:
| Q |
2 |
gcaaccataatgcttgaaaaaatgggagccaccgtcgttgctgtaggtgacggacaacaggcggtggatgctct |
75 |
Q |
| |
|
||||| ||||||||||||||||||||||| || |||||||||||||| |||||||| || ||||||||||| |
|
|
| T |
8870251 |
gcaacaataatgcttgaaaaaatgggagctgttgttgttgctgtaggtgatggacaacaagcagtggatgctct |
8870324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University