View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20593_low_31 (Length: 222)

Name: NF20593_low_31
Description: NF20593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20593_low_31
NF20593_low_31
[»] chr4 (1 HSPs)
chr4 (23-206)||(30480538-30480721)
[»] chr2 (1 HSPs)
chr2 (170-206)||(4142279-4142315)


Alignment Details
Target: chr4 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 23 - 206
Target Start/End: Complemental strand, 30480721 - 30480538
Alignment:
23 aatggacttgagaatccaaaaaactctgcaaaaatgtcatctgcattcctcggattgaaccgaaacgatccaggcatatctcctgtggaatagaaactag 122  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
30480721 aatggacttgagaatccaaaaaactctgcaaaaatgtcatctgcattcctcggattgaaccgaaacgacccaggcatatctcctgtggaatagaaactag 30480622  T
123 ttccacctccactaccagcatcaggaggaggaacttgaccctttaaaccttcttccccatattgatcatagattgctttctttt 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30480621 ttccacctccactaccagcatcaggaggaggaacttgaccctttaaaccttcttccccatattgatcatagattgctttctttt 30480538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 170 - 206
Target Start/End: Complemental strand, 4142315 - 4142279
Alignment:
170 ccttcttccccatattgatcatagattgctttctttt 206  Q
    |||||||| |||||||||||||| |||||||||||||    
4142315 ccttcttctccatattgatcataaattgctttctttt 4142279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University