View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20593_low_36 (Length: 219)
Name: NF20593_low_36
Description: NF20593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20593_low_36 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 18 - 209
Target Start/End: Complemental strand, 30509533 - 30509342
Alignment:
| Q |
18 |
cacttagcatgttagggaggaatcctgttgctgaacaaaatagagaaatgccaatagttggtgggactggactgttcaggtttgctaggggatatgtcat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30509533 |
cacttagcatgttagggaggaatcctgttgctgaacaaaatagagaaatgccaatagttggtgggactggactgttcaggtttgctaggggatatgtcat |
30509434 |
T |
 |
| Q |
118 |
agcaaacagtgtttactctatttcttcccctgagaattttgttatggagtacaatatcacagtgtatcatcatctttaaattatgccctttg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30509433 |
agcaaacagtgtttactctatttcttcccctgagaattttgttatggagtacaatatcacagtgtatcatcatctttaaattatgccctttg |
30509342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 18 - 209
Target Start/End: Original strand, 10971074 - 10971265
Alignment:
| Q |
18 |
cacttagcatgttagggaggaatcctgttgctgaacaaaatagagaaatgccaatagttggtgggactggactgttcaggtttgctaggggatatgtcat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10971074 |
cacttagcatgttagggaggaatcctgttgctgaacaaaatagagaaatggcaatagttggtgggactggactgttcaggtttgctaggggatatgtcat |
10971173 |
T |
 |
| Q |
118 |
agcaaacagtgtttactctatttcttcccctgagaattttgttatggagtacaatatcacagtgtatcatcatctttaaattatgccctttg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10971174 |
agcaaacagtgtttactctatttcttcccctgagaattttgttatggagtacaatatcacagtgtatcatcatctttaaattatgccctttg |
10971265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 26 - 87
Target Start/End: Complemental strand, 13703005 - 13702944
Alignment:
| Q |
26 |
atgttagggaggaatcctgttgctgaacaaaatagagaaatgccaatagttggtgggactgg |
87 |
Q |
| |
|
||||| || ||||||||| || |||||||||||||||||||||| || |||||||| ||||| |
|
|
| T |
13703005 |
atgttgggaaggaatcctatttctgaacaaaatagagaaatgcctattgttggtggaactgg |
13702944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University