View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20594_high_29 (Length: 292)
Name: NF20594_high_29
Description: NF20594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20594_high_29 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 7 - 254
Target Start/End: Complemental strand, 21216585 - 21216340
Alignment:
| Q |
7 |
agaagaagaaaaagggagatgtggtgtataaaattgatttggagaaagcttatcatcatgtgagctggacnnnnnnnnatagaactgtcttcaataattt |
106 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| || | ||||| ||||||||||||| |
|
|
| T |
21216585 |
agaagaataaaaagggagatgtggtgtataaaattgatttggagaaagcttatgatcatgtgagctgaactttttt--acggaactatcttcaataattt |
21216488 |
T |
|
| Q |
107 |
ggttttccatctattactattgatttaattatgcattgtgagactgtttcaagtctctcactcattttgaatggcacaaggttacttgcttttactccta |
206 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21216487 |
gattttccatctattactattgatttaattatgcattgtgagactgtttcaagtctctcactcattttgaatggcacaaggttacttgcttttactccta |
21216388 |
T |
|
| Q |
207 |
ctcgtggtcaacgttaaggggatcctctcttccctaatctttttgtaa |
254 |
Q |
| |
|
||||||| |||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
21216387 |
ctcgtggccaacgttaaggggatcctctctcgcctaatctttttgtaa |
21216340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University