View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20594_high_42 (Length: 227)
Name: NF20594_high_42
Description: NF20594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20594_high_42 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 86; Significance: 3e-41; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 138 - 227
Target Start/End: Complemental strand, 49478769 - 49478680
Alignment:
| Q |
138 |
ttttcgatggtcatacacaccatttcaaactctgaaaatgcaattctcaagtcgagtacatcgtcttcttgtttgcacaaaaaagcacaa |
227 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49478769 |
ttttctatggtcatacacaccatttcaaactctgaaaatgcaattctcaagtcgagtacatcgtcttcttgtttgcacaaaaaagcacaa |
49478680 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University