View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20594_high_9 (Length: 535)
Name: NF20594_high_9
Description: NF20594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20594_high_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 460; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 460; E-Value: 0
Query Start/End: Original strand, 18 - 512
Target Start/End: Original strand, 32726083 - 32726586
Alignment:
| Q |
18 |
cattggaccccttccatgatatcgtagtcgatgacatggacgcggcgttcgtgggccacggcttcgatgatggcttgattggctgtgaagtggccgaatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32726083 |
cattggaccccttccatgatatcgtagtcgatgacatggacgcggcgttcgtgggccacggcttcgatgatggcttgattggctgtgaagtggccgaatt |
32726182 |
T |
 |
| Q |
118 |
tgacgtaaggtgacatgtcttgaagtagttggaaagcagcaagtgtgtcgttttggttgtcgcggggaccatttgtggtgaggtaatgtttgttgttgtt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32726183 |
tgacgtaaggtgacatgtcttgaagtagttggaaagcagcaagtgtgtcgttttggttgtcgtggggaccatttgtggtgaggtaatgtttgttgttgtt |
32726282 |
T |
 |
| Q |
218 |
gtggtgatggtggttattatgcgcacccccagcaccttctagtagtccatgaagggcttcggtgaaatgagcggcaagtctctccatgttggagccgtta |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32726283 |
gtggtgatggtggttattatgcgcacccccagcaccttctagtagtccatgaagggcttcggtgaaatgagcggcaagtctctccatgttggagccgtta |
32726382 |
T |
 |
| Q |
318 |
gcatgttgtgagactaattccttgagccggatcaatatcactcgagctaagtcacggtttttggttgaaccggttaaggcttccgcgccagccatcaata |
417 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32726383 |
gcatgttgtgagactaattccttgagccggatcaatatcactcgagctaagtcacggtttttggttgaaccggttaaggcttccgcgccagccatcaata |
32726482 |
T |
 |
| Q |
418 |
ggtgcactagttttagcccttttgaatcatcaccaacttcttgcgtttttattgtcgttgtt---------gttgttgtttccatttcttcttcttcctc |
508 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
32726483 |
ggtgcactagttttagcccttttgaatcatcaccaacttcatgcgtttttattgccgttgttgttgttgtggttgttgtttccatttcttcttcttcctc |
32726582 |
T |
 |
| Q |
509 |
atcc |
512 |
Q |
| |
|
|||| |
|
|
| T |
32726583 |
atcc |
32726586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University