View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20594_low_29 (Length: 304)
Name: NF20594_low_29
Description: NF20594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20594_low_29 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 10 - 290
Target Start/End: Original strand, 3431495 - 3431775
Alignment:
| Q |
10 |
gcagagacacatgtcaaacgtggtgctctcgtgatgtttcatttcagaaaacccacattggtgagcaccacatgtcgacgttgctattgttgtccattgg |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
3431495 |
gcagagacacatgtcaaacgtggtgctctcgtgatgtttcatttcagaaaacccacattggcgagcaccacatgtcgaccttgctattgttgtccattgg |
3431594 |
T |
|
| Q |
110 |
acgtggacaatcggaggttcggtccaacgccttcattgtgtcataatctaataaaaaattgactgctttttatacaaccagtcacaggtcctctattttt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||| |
|
|
| T |
3431595 |
acgtggacaatcggaggttcggtccaacaccttcattgtgtcataatctaataaaaaattgactgctttttatacaaccagtcgcaagtcctctattttt |
3431694 |
T |
|
| Q |
210 |
ccttcccaaaactttttgtttcttgcattccgcaaagagcacagaatcattgcaaatttcatgtacctcagaggttccata |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3431695 |
ccttcccaaaactttttgtttcttgcattccacaaagagcacagaatcattgcaaatttcatgtacctcagaggttccata |
3431775 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University