View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20594_low_34 (Length: 252)
Name: NF20594_low_34
Description: NF20594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20594_low_34 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 53 - 241
Target Start/End: Complemental strand, 18888029 - 18887841
Alignment:
| Q |
53 |
atatgatgaatgcaagatgattagaaaactaattgattttgttttgaaagtatactacgagaaaaagtgtcttgcaatcactggagttcatcattacgac |
152 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18888029 |
atatgatgaatgcaagatgattagaaaactaattgattttgttttgaaagtatactacgaggaaaagtgtcttgcaatcactggagttcatcattacgac |
18887930 |
T |
 |
| Q |
153 |
aaacaaactaaatcgtattccatcttttcagctagaacatacatttttaaggatgaggtcttctctattgtattgcttacattatctct |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18887929 |
aaacaaactaaatcgtattccatcttttcagctagaacatacatttttaaggatgaggtcttctctattgtattgcttacattatctct |
18887841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 18891397 - 18891355
Alignment:
| Q |
1 |
tttttctctctcctaagtatgcaaataaagaaaattttctttt |
43 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18891397 |
tttttctctctcctaagtatgcaaataaagaaaattttctttt |
18891355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University